Error message

Deprecated function: The each() function is deprecated. This message will be suppressed on further calls in menu_set_active_trail() (line 2386 of /home/nixotca/public_html/gk12/includes/menu.inc).

alignment unmodified

>gi|353330142|gb|HQ438603.1| Cucurbita moschata voucher PI 653064 maturase K (matK) gene, partial cds; chloroplast
TTTTTAAATGGATCCATTTTTTTGGAAAATTCTGGTTATGACAAAAAATCCAGTTTACTAATGGTAAAAC
ATTTAATTACTCGAATGTATCACCAGAATCATTTTTTTTTTTCCACTAATTATGACAAAAATCCATTTTT
GGGGTACAAAAAAAATTTGTATTCTCAAATGCTATCCGAAGGGTTTGCAGTCATTGTGGAAATTCCATTT
TCCCTAAGATTAGTATCTTCCTTAGAGGAAGAAGAAATCGCAAAATCTTATAATTTACGATCAAGTCATT
CAATATTTCCTTTTTTAGAGGATAAATTACCACATTTAAATTATGTGTCAGATGTATTAATCCCCTATCC
CCTTCATCTGGAAATTTTAGTTCAAATCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTA
CGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTT
CAAAAAGAAATCAAAGATTAGTCTTGTTCCTATACAATTCTTATGTATGTGAATACGAATCCATTTTCCT
TTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAACGAATATATTTC
TATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGG
ATCCTTTCATACATTATGTTAGATATCAAGGAAAATTGATTCTGGTTTCAAAAGATACGCCACTTCTGAT
GAATAAGTGGAAATATTACCTTGTTAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGG
ATCCATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGATTAAATC
CTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACCAAGAAAATCGATAC
ACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAATGTGTTAGGGCATCCC
ATTAGTAAGCCGACCTGGATCGATTCGTCGGATTTTTCTATTATTGATCGATTTGTGCGTATATCCAGAA
ATCTTTCTCATTATTACAGAGGATCCTCA

 

>gi|111053096|gb|DQ536649.1| Citrullus colocynthis voucher Renner et al. 2762 (M), cult. Mainz BG maturase K (matK) gene, partial cds; chloroplast

TTTTTTAAATGGATCCATTTTGTTGGAAAATTCTGGTTATGACAAAAAATCCAGTTTACTAATGGTAAAA

CATTTAATTACTCGAATGTATCACCAGAATCATTTTTTTTTCACTAATTATTATAACAAAAATCCATTTT

TGGGGTACAACAAAAATTTGTATTCTCAAATGTTATCAGAAGGGTTTGCAGTCATTGTGGAAATTCCATT

TTCCCTACGATTAGTATCTTCCTTAGAGGAAGAAGAAATCGTAAAATCTTATAATTTACGATCAAGTCAT

TCAATATTTCCTTTTTTAGAGGATAAATTCCCACATTTAAATTATGTGTCAGATGTATTAATACCCTATC

CCCTCCATCTGGAAATTTTAGTTCAAACCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATT

ACGGTTCTTTTTTCACGAGTATTGTAATTTGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTT

TCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATACAATTCTTATGTATGTGAATACGAATCCATTTTCC

TTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTT

CTATGGAAAAATAGAACATCTTGTCAAAGTGTTTGCTAATTCTTTTTCGGCTATCTTACGGGTCTTCAAG

GATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGA

TTAATAAATGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAG

GATCTATATAAACCCATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGATTAAAT

CCTTCAGTGGTATGGAGTCAAATGTTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATA

CACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTCGGGCATCC

CATTAGTAAGCCGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGA

AATCTTTCTCATTATTACAGAGGATCCTCAA

 

>gi|340512935|gb|HM850818.1| Citrullus lanatus maturase K (matK) gene, partial cds; chloroplast
TGTCAGATGTATTAATACCCTATCCCCTCCATCTGGAAATTTTAGTTCAAACCCTTCGCTCCTGGGTGAA
AGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTTGAATAGTCTTAGTACT
TCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATACAATTCTTATG
TATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAG
GGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATAGAACATCTTGTCAAAGTGTTTGCTAATTCTTTT
TCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGG
TTTCAAAAGATACGCCACTTCTGATTAATAAATGGAAATATTACCTTGTCAATTTATGGCAATGTCATTT
TTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCCATTATCCAAGCGTTCTCTTGACTTTTTGGGC
TATATTTCAAGTGTGCGATTAAATCCTTCAGTGGTATGGAGTCAAATGTTAGAAAATTCATTTCTAATAG
ATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAA
ATTTTGTAACGTGTTCGGGCATCCCATTAGTAAGCCGACCTGGATCGATTCGTCGGATTTTGATATTATT
GATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACA

 

>gi|340512931|gb|HM850816.1| Cucumis melo maturase K (matK) gene, partial cds; chloroplast
TGTCAGATGTATTAATACCCTATCCCCTCCATCTGGAAATTTTAGTTCAAATCCTTCGCTCCTGGGTGAA
AGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTTGAATAGTCTTAGTACT
TCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATACAATTCTTATG
TATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAG
GGGCTTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTT
TCGGCTATCTTACGGATCTTCAAGGATCCTTTGATACATTATGTTAGATATCAAGCAAAATCTATTCTGG
TTTCAAAAGATACGCCACTTCTTATTAATAAGTGGAAATATTACTTTGTCAATTTATGGCAATGTCATTT
TTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGC
TATATTTCAAGTGTTCGATTAAATACTTCAGTGGTATGGACTCAGATGTTAGAAAATTCATTTCTAATAG
ATAATGCTACCAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAA
ATTTTGTAACGTCTTAGGACATCCCATTAGTAAGCCGAACTGGATCGATTCGTCGGATTTTGATATTATT
GATCGATTTTTGCGTATATCCAGAAATCTTTCTCATTATTACA

 

>gi|111053217|gb|DQ536711.1| Cucumis oreosyce voucher E. Phillips 2821 (Z) maturase K (matK) gene, partial cds; chloroplast
TTTTTTAAATGGATCCATTTTGTTGGAAAATTCTGGTTATGACAAAAAATCCAGTTTACTAATGGTAAAA
CATTTAATTACTCGAATGTATCACCAGAATCATTTTTTTTTTCCACTAATTATAAAAAAAAAAAATCCAT
TTTTGGGGTACAACAACAATTTGTATTCTCAAATGTTATCAGAAGGGTTTGCAGTCATTGTGGAAATTCC
ATTTTACCTACGATTAGTATCTTCCTTAGAAGAAGAAGAAATCGCAAAATCTTATAATTTACGATCAAGT
CATTCAATATTTCCTTTTTTAGAGGATAAATTCCCACACTTAAATTATGTGTCAGATGTATTAATACCCT
ATCCCCTCCATCTGGAAATTTTAGTTCAAATCCTTCGTTCCTGGGTGAAAGATGCCTCTTCTTTTCATTT
ATTACGGTTCTTTTTTCACGAGTATTGTAATTTGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTT
TTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATACAATTCTTATGTATGTGAATACGAATCCATTT
TCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATA
TTTCTATGGAAAAATCGAACATCTTGTCAAAGTTTTTGCTAATTATTTTTCGGCTATCTTAGGGGTCTTC
AAGGATCCTTTCATACATTATGTTAGATATCAAGCAAAATCTATTCTGGTTTCAAAAGATACGCCACTTC
TGATTAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGA
AAGGATCTATATAACCCAA
>gi|111053206|gb|DQ536705.1| Cucumis maderaspatanus voucher J. Maxwell 02-434 (CMU) maturase K (matK) gene, partial cds; chloroplast
TTTTTTAAATGGATCCATTTTGTTGGAAAATTCTGGTTATGACAAAAAATCCAGTTTACTAATGGTAAAA
CATTTAATTACTCGAATGTATCACCAGAATCATTTTTTTTTTTCCACTAATTATTATAACAAAAATCCTT
TTTGGGGGTACAACAACAATTTGTATTCTCAAATGTTATCAGAAGGGTTTGCAGTCATTGTGGAAATTCC
ACTTTCCCTACGATTAGTATCTTCCTTAGAAGAAGAAGAAATCGCAAAATCTTATAAATTACGATCAAGT
CATTCAATATTTCCTTTTTTAGAGGATAAATTCCCACATTTAAATTATGTGTCAGATGTATTAATACCCT
ATCCCCTCCATCTGGAAATTTTAGTTCAAATCCTTCGCTCCTGGGTGAAAGATGTCTCTTCTTTTCATTT
ATTACGGTTCTTTTTTCACGAGTATTGTAATTTGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTT
TTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATACAATTCTTATGTATGTGAATACGAATCCATTT
TCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAAGGGGCTTTTTGAGCGAATATA
TTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTC
AAGGATCCTTTGATACATTATGTTAGATATCAAGCAAAATCTATTCTGGTTTCAAAAGATACGCCACTTC
TGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGA
AAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGATTA
AATCCTTCAGTGGTATGGACTCAGATGTTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCG
ATACACTAGTTCCTATTATTACTCTGCTTGCATCATTGGCTAAAGCGAAATTTTGTAACGTCTTAGGACA
TCCCATTAGTAAGCCGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTTTGCGTATATCC
AGAAATCTTTCTCATTATTACAGAGGATCCTCAA
>gi|284022342|gb|GQ163457.1| Momordica welwitschii voucher M:B. de Winter & O. A. Leistner 5789 maturase K (matK) gene, partial cds; chloroplast
ATGCATTTTCTCATGATCATTTTTTAAATGGATCCATTTTGTTGGAAAATTCTGGTTATGACAAAAAATC
CAGTTTACTAATGGTAAAACATTTAATTACTCGAATGTATCAACAGAATCATTTTTTTTTTTCCACTAAT
TATAACAAAAATCCATTTTTGGGGTACAACAAAAATTTGTATTCTCAAATGCTATCAGAAGGGTTTGCAG
TCATTGGGGAAATTCCATTTTCCCTACGATTAGTACCTTCTTTAGAGGAAGAAGAAATCGCAAAATCTTA
TAATTTACGATCAAGTCATTCAATATTTCCTTTTTTAGAGGATAAATTCCCACATTTAAATTATGTGTCA
GATGTATTAATATCCTATCCCCTCCATCTGGAAATTTTAGTTCAAATGCTTCGCTCCTGGGTGAAAGATG
CCTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAA
AAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGT
GAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTATTATAGGGGCC
TTTTTGAGCGAATATATTTCTATGGAAAAATAGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGC
TATCTTACGGGTCTTTAAGGATCCTTTCGTGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCA
AAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATG
TGTGGTCACAACCAGAAAGGATCGATATAAACCAATTATCCAAGCGTTCTCTTGAATTTTTGGGCTATAT
TTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAAT
GCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCTAAATTTT
GTAACGTATTAGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCG
ATTTGTGCGTATATCCAG
>gi|284022338|gb|GQ163455.1| Momordica trifoliolata voucher MO:R. Gereau 1455 maturase K (matK) gene, partial cds; chloroplast
ATGCATTTTCTCATGATCATTTTTTAAATGGATCCATTTTGTTGGAAAATTCTGGTTATGACAAAAAATC
CAGTTTACTAATGGTAAAACATTTAATTACTCGAATGTATCAACAGAATCATTTTTTTTTTTTTTCCACT
AATTATAACAAAAATCCATTTTTGGGGTACAACAAAAATTTGTATTCTCAAATGCTATCAGAAGGGTTTG
CAGTCATTGTGGAAATTCCATTTTCCCTACGATTAGTACCTTCTTTAGAGGAAGAAGAAATCACAAAATC
TTATAATTTACGATCAAGTCATTCAATATTTCCTTTTTTAGAGGATAAATTCCCACATTTTAATTATGTG
TCAGATGTATTAATACCCTATCCCCTCCATCTGGAAATTTTAGTTCAAATCCTTCGTTCCTGGGTGAAAG
ATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTC
AAAAAAATTTATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTA
TGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGG
GCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTC
GGCTATCTTACGGGTCTTTAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTT
TCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATATCATTTTT
ATGTTTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTA
TATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGAT
AATGCTACGAATAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAAT
TTTGTAACGTATTGGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGA
TCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAAGAATTTGTAT
CGAATCAAATATATACT